Open Access

Elevated Protein Tyrosine Phosphatase Kappa Expression Is Associated With Disease Progression and Poor Prognosis of Pancreatic Cancer

ZIQIAN FANG 1
, 
XIANGYI LIU 1
, 
XIUYUN TIAN 2
, 
BILAL AL-SARIREH 3
, 
CHUNYI HAO 2
, 
WEN G. JIANG 1
  &  
LIN YE 1

1Cardiff China Medical Research Collaborative, Division of Cancer & Genetics, Cardiff University School of Medicine, Cardiff, U.K.

2Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education, Beijing), Department of Hepato-Pancreato-Biliary Surgery, Peking University Cancer Hospital & Institute, Beijing, P.R. China

3Department of Surgery, Morriston Hospital, ABM University Health Board, Swansea, U.K.

Cancer Diagnosis & Prognosis May-Jun; 6(3): 596-607 DOI: 10.21873/cdp.10560
Received 18 December 2025 | Revised 06 March 2026 | Accepted 12 March 2026
Corresponding author
Dr. Lin Ye, Cardiff China Medical Research Collaborative, Division of Cancer & Genetics, Cardiff University School of Medicine, Academic Avenue, Cardiff, CF14 4XN, U.K. Tel: +44 2920687861, e-mail: YeL@Cardiff.ac.uk
Download PDF pdf image icon

Abstract

Background/Aim
Protein tyrosine phosphatase kappa (PTPRK), a recognized tumor suppressor, has been implicated in cancer progression of certain solid tumors. This study investigated the role of PTPRK in the progression of pancreatic cancer.
Materials and Methods
PTPRK transcripts were determined in a pancreatic cancer cohort using real-time PCR. The functional impact of PTPRK was evaluated in pancreatic cancer cells with PTPRK knockdown, followed by an assessment of its implications in disease progression.
Results
Elevated PTPRK expression was observed in pancreatic cancer and was positively correlated with tumor T stage. Knockdown of PTPRK led to reduced cellular proliferation and decreased expression of cyclin-dependent kinase 6 (CDK6). Additionally, an increase in VEGFC expression was noted in PTPRK knockdown cells.
Conclusion
Up-regulation of PTPRK in pancreatic cancer is associated with disease progression and poor prognosis. PTPRK facilitates cancer cell proliferation through CDK6, highlighting the potential for therapeutic strategies targeting PTPRK and CDK6 in pancreatic cancer treatment.
Keywords: PTPRK, pancreatic cancer, prognosis

Introduction

Pancreatic cancer is associated with an exceptionally high mortality rate, ranking among the top five causes of cancer-related deaths (1). Owing to the absence of early symptoms, the disease often remains undetected until advanced stages, with approximately 80% of patients presenting with metastasis (1). The five-year survival rate remains below 6%, reflecting the limited effectiveness of current therapeutic strategies.

Phosphorylation is crucial in regulating cellular functions (2), with tyrosine, threonine, and serine being the most frequently phosphorylated amino acids (2). Dysregulated phosphorylation has been implicated in cancer progression (2-4). Tyrosine kinases such as epidermal growth factor receptor (EGFR), platelet-derived growth factor receptor (PDGFR), and vascular endothelial growth factor receptors (VEGFRs) respond to growth factors and hormones. Mutations in these kinases often lead to aberrant phosphorylation. Targeted therapies, including imatinib and gefitinib, have been developed to inhibit these kinases (5, 6).

EGFR and its downstream signaling molecule RAS, particularly KRAS, play critical roles in pancreatic cancer progression (7, 8). KRAS mutations promote uncontrolled proliferation by activating MAPK and PI3K pathways (9, 10). Although inhibitors targeting the MAPK pathway, such as BRAF kinase inhibitors, have been explored, they may inadvertently activate the pathway through BRAF and CRAF dimerization. Similarly, inhibitors of PI3K, AKT, and mTOR have demonstrated anti-tumor effects in preclinical models but show limited clinical benefit in pancreatic cancer (11-13).

Protein tyrosine phosphatase kappa (PTPRK) is a transmembrane tyrosine phosphatase belonging to the type IIb family of receptor protein tyrosine phosphatases (RPTP), also known as the R2B superfamily. Structurally similar to cell adhesion molecules (CAMs), the PTPRK gene is located on the long arm of chromosome 6 (14). PTPRK shares the conserved structural organization characteristic of RPTP, consisting of an extracellular region, a transmembrane segment and intracellular catalytic domains (15). Its extracellular region contains a MAM domain, an immunoglobulin-like domain and four fibronectin type III repeats, enabling interactions with β- and γ-catenin at adherens junctions and contributing to the regulation of cell-cell adhesion (16-18). While PTPRK plays a role in nervous system development, its exact mechanism remains unclear (14).

PTPRK is considered a tumor suppressor in breast cancer, where its reduced expression is associated with poor prognosis, increased proliferation, adhesion disruption, and enhanced invasion capacity (14, 19). Similarly, PTPRK inhibits the proliferation and invasion of glioma and melanoma cells by modulating oncogenic signaling pathways including EGFR and β-catenin (14, 20). In lung cancer, PTPRK suppresses tumor cell proliferation, invasion, and migration through an inhibition of STAT3 (21).

A recent study has also demonstrated that PTPRK regulates cell-cell adhesion and epithelial organization, suppressing epithelial-mesenchymal transition (EMT) and tumor invasion in colorectal cancer models (22). At the molecular level, PTPRK can directly dephosphorylate receptor tyrosine kinases such as EGFR, thereby attenuating downstream signaling pathways that drive tumor cell proliferation and migration (23). Structural alterations involving PTPRK, including PTPRK-RSPO3 gene fusions, have been reported in gastrointestinal cancers and are known to activate Wnt signaling pathways (24). Recent evidence indicates that PTPRK also participates in metabolic regulation, controlling glycolysis and de novo lipogenesis during hepatocyte metabolic reprogramming (25). Additionally, Epstein-Barr Virus infection can disrupt PTPRK expression, contributing to Hodgkin lymphoma development (26).

Despite these findings, the role of PTPRK in pancreatic cancer remains poorly understood. Recent genomic studies have identified alterations in several classical protein tyrosine phosphatases, including PTPRK, in pancreatic ductal adenocarcinoma, suggesting that dysregulation of this phosphatase may contribute to tumor progression and could represent a potential prognostic biomarker (27). This study aimed to investigate the involvement of PTPRK in the progression of pancreatic cancer.

Materials and Methods

Tissue sample collection. Tissue samples from pancreatic cancers (n=201) and adjacent non-tumor pancreatic tissues (n=201) were collected immediately after surgery at Peking University Cancer Hospital. All procedures used are approved by the Peking University Cancer Hospital Research Ethics Committee (MTA01062008).

Public pancreatic cancer datasets. The implication of PTPRK in disease progression and prognosis was also analyzed with RNA sequencing data of pancreatic cancer (n=177) [The Cancer Genome Atlas (TCGA)_PAAD)] and two gene array datasets: GSE15471 (N=39, tumor samples with paired adjacent normal pancreatic tissues) (28) and GSE71729 (N=357) (29).

Cell lines and cell culture. Human pancreatic cancer cell lines PANC-1 and CFPAC-1 were purchased from ATCC (American Type Culture Collection, Manassas, VA, USA). Both cell lines were cultured in DMEM-F12 medium supplemented with 10% FCS and antibiotics. Unless specifically stated, materials and reagents were purchased from Sigma Aldrich (Dorset, UK).

RNA extraction, reverse transcription, and quantitative real-time PCR (qPCR). TRIzol reagent (Sigma-Aldrich) was used to extract the RNA. GoScript reverse transcription mix (Promega, Southampton, UK) was used for reverse transcription. FAST 2X qPCR MasterMix (Primer Design, Chandler’s Ford, UK) was used for qPCR. Primers used for quantitative PCR include the GAPDH forward (5’-CTGAGTACGTCGTGGAGTC) and GAPDH reverse (5’-ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG); PTPRK forward (5’-AATTACAATTGATGGGGAGA) and PTPRK reverse (5’-ACTGAACCTGACCGTACATATTGTGTGACGATGAAAGC); CDK6 forward (5’-AAATCTTGGACGTGATTGGA) CDK6 reverse (5’-ACTGAACCTGACCGTACATTCAGAAGTAGGTCTTTGCC); cyclin D1 forward (CGGTGTCCTACTTCAAATGT) cyclin D1 reverse (5’-ACTGAACCTGACCGTACACAAAGCGGTCCAGGTAGTTC); and VEGFC forward (5’-GGAAAGAAGTTCCACCACCA) VEGFC reverse (5’-ACTGAACCTGACCGTACAGAAAATCCTGGCTCACAAGC). The 2–ΔΔCT method was applied to the quantitative analysis (30).

Western blot. RIPA lysis buffer was used to extract the cellular protein, which was quantified using a BioRad protein quantification kit (BioRad, Hertfordshire, UK). For each sample, 34 μg protein was loaded and separated in 8% SDS-PAGE gel. Proteins were then transferred onto the 0.45μm PVDF membrane (Merck Millipore, Hertfordshire, UK) with a semi-dry blotter. After a blocking with 10% skimmed milk in room temperature for 1 h, anti-GAPDH (1:4,000; sc32233; Santa Cruz Biotechnology, Dallas, TX, USA) and anti-PTPRK (1:1,000; sc28906; Santa Cruz Biotechnology) were applied respectively with an incubation at 4℃ for overnight. After another incubation (1 h, room temperature) with secondary antibodies: anti-mouse IgG (1:1,000; A5278; Sigma Aldrich) and anti-rabbit IgG (1:1,000; A6154; Sigma Aldrich), protein bands were visualized using EZ-ECL solution (Cat. No. 1921593; Biological industries, Cromwell, CT, USA). UVITech imager (UVITech, Cambridge, UK) was used for photographing.

Establishment of PTPRK knockdown cell line model. PTPRK ribozymes were synthesized and then cloned into pEF6/V5-His TOPO® TA plasmid vectors (Thermo Fisher Scientific, Waltham, MA, USA) as previously described (31). PANC-1 and CFPAC-1 cells were transfected with the PTPRK ribozymes (PTPRK kd) and the empty vectors (PEF) as control followed by a selection with 4 µg/ml blasticidin. After a verification of the knockdown using PCR and western blot, the cells were maintained in a culture medium containing 0.5 µg/ml blasticidin.

In vitroproliferation. Proliferation of PANC-1 CFPAC-1 over a duration up to five days was determined in cultures initially seeded 3,000 and 5,000 cells per well, respectively. Cells were fixed with 4% formaldehyde and then stained with Crystal violet (0.5%). Absorbance was measured at a 590 nm wavelength using a spectrophotometer (BIO-TEK, Elx800, Cheadle, UK).

In vitro adhesion. A 96-well plate was precoated with 5 μg Matrigel/well (BD Matrigel™ Basement Membrane Matrix, Corning Incorporated, Flintshire, UK) and air dried. After a rehydration for 30 min at room temperature, 30,000 cells were seeded into each well followed by an incubation at 37℃ for 40 min. After two washes with PBS, adherent cells were fixed with 4% formaldehyde, following staining with crystal violet. Absorbance at a 590 nm wavelength was determined using a spectrophotometer.

In vitro invasion. Transwell inserts with 8-μm pores were precoated with 50 μg Matrigel. 30,000 cells were added into each insert. After a 3-day incubation, cells that invaded through the Matrigel were fixed with 4% formalin, stained with 1% crystal violet and counted.

In vitro wound healing assay. Cells were seeded into a 24-well plate to form a monolayer before the test. The cells were scratched and migration of the cells was then monitored using EVOS system (Thermo Fisher Scientific). Closure of the wounds was measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

CDK inhibitor treatment and cell viability assay. To evaluate the role of CDKs in the proliferation of pancreatic cancer cells following PTPRK knockdown, cells were treated with specific CDK inhibitors. The CDK6 inhibitor BSJ-03-123 (Cat. No. 6921; TOCRIS, Bristol, UK), the dual CDK4/6 inhibitor Palbocicilib (Cat. No. S1116 Selleckchem, Houston, TX, USA), and the CDK4 inhibitor 3-ATA (Cat. No. sc-202414; Santa Cruz Biotechnology) were dissolved in DMSO to prepare stock solutions and further diluted in culture medium, with the final DMSO concentration kept below 0.1%. Cells were seeded into 96-well plates and exposed to serial dilutions of BSJ-03-123 (0.015-250 µM), Palbociclib (0.049-800 nM), or 3-ATA (0.012-200 µM) for 72 h. Following treatment, cells were fixed with 4% formaldehyde, then was stained with 0.5% crystal violet. The absorbance was measured at 590 nm using a spectrophotometer (BIO-TEK, Elx800). IC50 values were determined from the dose-response curves using GraphPad Prism software (Version 10, GraphPad Software, San Diego, CA, USA).

Statistical analysis. Mann–Whitney U-test was used for non-normally distributed data, and t-test was used for normally distributed data. The correlation between genes was analyzed using the Spearman test. All the statistical analyses were performed with SPSS software (version 26, SPSS, Chicago, IL, USA). Kaplan–Meier survival analysis was conducted using KMplot, or using SPSS for the GSE71729 (28). p<0.05 was considered as statistically significant.

Results

Aberrant expression of PTPRK in pancreatic cancer. In the Beijing clinical cohort, the qPCR results showed that PTPRK expression was significantly increased in pancreatic tumors compared with adjacent normal pancreatic tissues. In comparison with pancreatic ductal carcinomas, the PTPRK transcript levels were higher in adenocarcinomas. Moreover, PTPRK expression in the tumors with lymph node metastasis was lower than its expression in the tumors without lymph node metastasis. PTPRK expression was also higher in larger and more invasive tumors with a higher T stage including T2, T3, and T4 compared with T1 tumors (Table I).

To determine whether PTPRK expression is altered in pancreatic cancer, its expression in normal and tumor tissues was further analyzed in both GSE15471 and GSE71729 cohorts. An up-regulation of PTPRK in pancreatic cancers was also revealed in both cohorts (Figure 1A and B). Kaplan–Meier survival analysis showed that higher PTPRK transcript levels were associated with poor overall survival (OS) (cut off value=2,199) and shorter relapse-free survival (RFS) (cut-off value=2,673) (Figure 1C and D).

Influence of PTPRK on the proliferation of pancreatic cancer cells. PTPRK Knockdown was established in both PANC-1 and CFPAC-1 cell lines (Figure 2). Reduced proliferation was observed in both PANC-1PTPRK kd and CFPAC-1PPTPRK kd cell lines in comparison with corresponding control cells (Figure 3A and B). More interestingly, reduced expression of CDK6 was seen in both PANC-1PTPRKrib and CFPAC-1PTPRKrib cells whilst CCND1 was decreased in PANC-1 cells following the knockdown of PTPRK (Figure 3C and D). Further analyses showed that PTPRK transcript levels were positively correlated with both CDK6 and CCND1 in pancreatic tumors (Figure 3E and F). No significant changes were observed in the migration and invasion of those two pancreatic cancer cell lines following the knockdown of PTPRK (data not shown).

CDK6 and tumor growth in pancreatic cancer with PTPRK knockdown. CDK inhibitors were applied to examine the involvement of CDKs in the proliferation of pancreatic cancer cells following the knockdown of PTPRK. Both CFPAC-1PTPRK kd and PANC-1PTPRK kd exhibited a resistance to the CDK6 inhibitor BSJ-03-123 with significantly increased IC50 concentrations in comparison with CFPAC-1pEF and PANC-1pEF, respectively (Figure 4A and B). The PTPRK knockdown also resulted in a tolerance to the treatment with Palbociclib, which is an inhibitor targeting both CDK4 and CDK6 (Figure 4C and D), but less compared with the CDK6 inhibitor BSJ-03-123. IC50 of Palbociclib was 2222.49 nM for the PANC-1PTPRK kd and higher than the control (p=0.031). The IC50 of Palbociclib was also higher in the CFPAC-1PTPRK kd compared with the control (p=0.051) but not significant. In contrast to BSJ-03-123 and Palbociclib, both CFPAC-1PTPRK kd and PANC-1PTPRK kd presented similar responses to the treatment with the CDK4 inhibitor 3-ATA in comparison with the corresponding control (Figure 4E and F).

PTPRK and lymph node metastasis in pancreatic cancer. In the Beijing cohort, reduced expression of PTPRK was seen in the primary tumors which developed lymph node metastases (Table I). A further analysis revealed an inverse correlation between PTPRK and the pro-lymphangiogenic factor VEGFC in the TCGA cohort of pancreatic cancer. Increased transcript levels of VEGFC were also seen in both PANC-1PTPRKrib and CFPAC-1PTPRKrib cell lines (Figure 5).

Discussion

PTPRK has been widely regarded as a tumor suppressor; in breast cancer, its reduced expression is associated with poor prognosis and increased proliferation, adhesion, and invasive capacity of cancer cells (14, 19, 21). Mutations or loss of PTPRK function have been linked to the development of various cancers, including colorectal cancer, glioma, breast cancer, central nervous system lymphomas, lung cancer, and primary intraocular lymphoma (14, 19, 20, 26).

Interestingly, this study found an up-regulation of PTPRK in pancreatic cancer. Its expression is positively correlated with higher T stages. Patients with elevated PTPRK transcript levels had poorer prognosis. PTPRK knockdown resulted in an inhibition of proliferation in the two pancreatic cancer cell lines examined. However, little impact on adhesion, migration and invasion was observed (data not shown). This suggests that PTPRK may play a contrasting role in pancreatic cancer compared with its previously reported tumor-suppressive functions in other malignancies (21, 26).

The study further observed that PTPRK knockdown led to decreased transcript levels of CDK6 and CCND1, which are key regulators of cell growth. CDKs regulate cell cycle progression, with CDK4 and CDK6 interacting with cyclins D1, D2, and D3 to promote the G1-to-S phase transition by phosphorylating the RB protein (32, 33). CDK4/6 activity is tightly regulated by cyclin-dependent kinase inhibitors, including p15, p16, p18, p19, WAF1, p21, p27, and p57 (32-38). Dysregulation of CDK4/6 activation and expression has been implicated in numerous human cancers.

Independent of CDK4/6 alterations, up-regulation of cyclin D expression can drive cancer progression (39, 40). CCND1 expression is regulated by the MAPK and PI3K-AKT pathways (41, 42). CDK4/6 inhibitors, such as palbociclib, have demonstrated efficacy in clinical trials for mantle cell lymphoma (43). Moreover, PTPRK knockdown resulted in a good tolerance to the CDK6 inhibitor BSJ-03-123, but to a lesser extent to the Palbociclib. This suggests that PTPRK may serve as a marker for CDK6 targeted therapy, which could be further evaluated in a clinical trial. Furthermore, this research highlights the potential of targeted therapies against PTPRK and CDK6 in pancreatic cancer.

However, another important observation from the present study was the lower PTPRK transcript level seen in primary tumors that presented lymph node metastases at the diagnosis of the disease. Further analysis revealed an inverse correlation between PTPRK and VEGFC, which is a key promotive factor for lymphangiogenesis and lymph node involvement (44). In line with this observation, an increased expression of VEGFC was also detected in pancreatic cancer cell lines following the PTPRK knockdown. This suggests that PTPRK plays as different role in lymph metastasis, which is yet to be further investigated.

In conclusion, PTPRK is up-regulated in pancreatic cancer, and its increased expression is associated with poor prognosis. PTPRK can promote proliferation through regulation of CDK6, although it may play a different role in lymph node metastasis. Collectively, these findings identify PTPRK as a potential prognostic biomarker and therapeutic target. Further investigation is required to elucidate its mechanistic roles and to validate its suitability for targeted therapeutic intervention in pancreatic cancer.

Conflicts of Interest

The Authors declare that they have no competing interests in relation to this study.

Authors’ Contributions

LY and WJ conceived the study. XT, CH and WJ collected tissues and performed data analysis. ZF and XL performed experiments and statistical analysis. ZF and XL prepared a draft of the manuscript, which was revised by LY, CH, BA and WJ. All Authors have read and agreed to the published version of the manuscript.

Funding

Not applicable.

Artificial Intelligence (AI) Disclosure

No artificial intelligence (AI) tools were used in the preparation of the manuscript and data analysis.

References

1 Stoop TF ,  Javed AA ,  Oba A ,  Koerkamp BG ,  Seufferlein T ,  Wilmink JW & Besselink MG .  Pancreatic cancer. Lancet. 405(10485) 1182 - 1202 2025. DOI: 10.1016/S0140-6736(25)00261-2
2 Zhang WJ ,  Zhou Y ,  Zhang Y ,  Su YH & Xu T .  Protein phosphorylation: A molecular switch in plant signaling. Cell Rep. 42(7) 112729 2023. DOI: 10.1016/j.celrep.2023.112729
3 Dong Y ,  Hu H ,  Zhang X ,  Zhang Y ,  Sun X ,  Wang H ,  Kan W ,  Tan MJ ,  Shi H ,  Zang Y & Li J .  Phosphorylation of PHF2 by AMPK releases the repressive H3K9me2 and inhibits cancer metastasis. Signal Transduct Target Ther. 8(1) 95 2023. DOI: 10.1038/s41392-022-01302-6
4 Cheng S ,  Wan X ,  Yang L ,  Qin Y ,  Chen S ,  Liu Y ,  Sun Y ,  Qiu Y ,  Huang L ,  Qin Q ,  Cui X ,  Wu M & Liu M .  RGCC-mediated PLK1 activity drives breast cancer lung metastasis by phosphorylating AMPKα2 to activate oxidative phosphorylation and fatty acid oxidation. J Exp Clin Cancer Res. 42(1) 342 2023. DOI: 10.1186/s13046-023-02928-2
5 Di Vito A ,  Ravegnini G ,  Gorini F ,  Aasen T ,  Serrano C ,  Benuzzi E ,  Coschina E ,  Monesmith S ,  Morroni F ,  Angelini S & Hrelia P .  The multifaceted landscape behind imatinib resistance in gastrointestinal stromal tumors (GISTs): A lesson from ripretinib. Pharmacol Ther. 248 108475 2023. DOI: 10.1016/j.pharmthera.2023.108475
6 Lu S ,  Dong X ,  Jian H ,  Chen J ,  Chen G ,  Sun Y ,  Ji Y ,  Wang Z ,  Shi J ,  Lu J ,  Chen S ,  Lv D ,  Zhang G ,  Liu C ,  Li J ,  Yu X ,  Lin Z ,  Yu Z ,  Wang Z ,  Cui J ,  Xu X ,  Fang J ,  Feng J ,  Xu Z ,  Ma R ,  Hu J ,  Yang N ,  Zhou X ,  Wu X ,  Hu C ,  Zhang Z ,  Lu Y ,  Hu Y ,  Jiang L ,  Wang Q ,  Guo R ,  Zhou J ,  Li B ,  Hu C ,  Tong W ,  Zhang H ,  Ma L ,  Chen Y ,  Jie Z ,  Yao Y ,  Zhang L ,  Jie W ,  Li W ,  Xiong J ,  Ye X ,  Duan J ,  Yang H ,  Sun M ,  Sun C ,  Wei H ,  Li C ,  Ali SM ,  Miller VA & Wu Q .  AENEAS: a randomized phase III trial of aumolertinib versus gefitinib as first-line therapy for locally advanced or metastaticnon-small-cell lung cancer with EGFR Exon 19 deletion or L858R mutations. J Clin Oncol. 40(27) 3162 - 3171 2022. DOI: 10.1200/JCO.21.02641
7 Mucciolo G ,  Araos Henríquez J ,  Jihad M ,  Pinto Teles S ,  Manansala JS ,  Li W ,  Ashworth S ,  Lloyd EG ,  Cheng PS ,  Luo W ,  Anand A ,  Sawle A ,  Piskorz A & Biffi G .  EGFR-activated myofibroblasts promote metastasis of pancreatic cancer. Cancer Cell. 42(1) 101 - 118 2024. DOI: 10.1016/j.ccell.2023.12.002
8 Du L ,  Su Z ,  Wang S ,  Meng Y ,  Xiao F ,  Xu D ,  Li X ,  Qian X ,  Lee SB ,  Lee JH ,  Lu Z & Lyu J .  EGFR-induced and c-Src-mediated CD47 phosphorylation inhibits TRIM21-dependent polyubiquitylation and degradation of CD47 to promote tumor immune evasion. Adv Sci (Weinh). 10(27) e2206380 2023. DOI: 10.1002/advs.202206380
9 Hitchen N ,  Williams S & Desai J .  Recent advances in therapeutic targeting of the KRAS pathway in cancer. Pharmacol Ther. 273 108889 2025. DOI: 10.1016/j.pharmthera.2025.108889
10 Chen Z ,  Chen M ,  Fu Y & Zhang J .  The KRAS signaling pathway’s impact on the characteristics of pancreatic cancer cells. Pathol Res Pract. 248 154603 2023. DOI: 10.1016/j.prp.2023.154603
11 De Santis MC ,  Bockorny B ,  Hirsch E ,  Cappello P & Martini M .  Exploiting pancreatic cancer metabolism: challenges and opportunities. Trends Mol Med. 30(6) 592 - 604 2024. DOI: 10.1016/j.molmed.2024.03.008
12 Xu R ,  Song J ,  Ruze R ,  Chen Y ,  Yin X ,  Wang C & Zhao Y .  SQLE promotes pancreatic cancer growth by attenuating ER stress and activating lipid rafts-regulated Src/PI3K/Akt signaling pathway. Cell Death Dis. 14(8) 497 2023. DOI: 10.1038/s41419-023-05987-7
13 Dilly J ,  Hoffman MT ,  Abbassi L ,  Li Z ,  Paradiso F ,  Parent BD ,  Hennessey CJ ,  Jordan AC ,  Morgado M ,  Dasgupta S ,  Uribe GA ,  Yang A ,  Kapner KS ,  Hambitzer FP ,  Qiang L ,  Feng H ,  Geisberg J ,  Wang J ,  Evans KE ,  Lyu H ,  Schalck A ,  Feng N ,  Lopez AM ,  Bristow CA ,  Kim MP ,  Rajapakshe KI ,  Bahrambeigi V ,  Roth JA ,  Garg K ,  Guerrero PA ,  Stanger BZ ,  Cristea S ,  Lowe SW ,  Baslan T ,  Van Allen EM ,  Mancias JD ,  Chan E ,  Anderson A ,  Katlinskaya YV ,  Shalek AK ,  Hong DS ,  Pant S ,  Hallin J ,  Anderes K ,  Olson P ,  Heffernan TP ,  Chugh S ,  Christensen JG ,  Maitra A ,  Wolpin BM ,  Raghavan S ,  Nowak JA ,  Winter PS ,  Dougan SK & Aguirre AJ .  Mechanisms of resistance to oncogenic KRAS inhibition in pancreatic cancer. Cancer Discov. 14(11) 2135 - 2161 2024. DOI: 10.1158/2159-8290.CD-24-0177
14 Zheng C ,  Liu T ,  Wang AQ ,  Chen XA ,  Zhang RZ ,  Wang XC ,  Lv CY ,  Pan RL ,  Wang OC & Lu XC .  Protein tyrosine phosphatase receptor type kappa (PTPRK) revisited: evolving insights into structure, function, and pathology. J Transl Med. 23(1) 534 2025. DOI: 10.1186/s12967-025-06496-1
15 Rothlin CV ,  Carrera-Silva EA ,  Bosurgi L & Ghosh S .  TAM receptor signaling in immune homeostasis. Annu Rev Immunol. 33 355 - 391 2015. DOI: 10.1146/annurev-immunol-032414-112103
16 Adam AP .  Regulation of endothelial adherens junctions by tyrosine phosphorylation. Mediators Inflamm. 2015 272858 2015. DOI: 10.1155/2015/272858
17 Fuchs M ,  Müller T ,  Lerch MM & Ullrich A .  Association of human protein-tyrosine phosphatase κ with members of the armadillo family. J Biol Chem. 271(28) 16712 - 16719 1996. DOI: 10.1074/jbc.271.28.16712
18 Craig SE & Brady-Kalnay SM .  Regulation of development and cancer by the R2B subfamily of RPTPs and the implications of proteolysis. Semin Cell Dev Biol. 37 108 - 118 2015. DOI: 10.1016/j.semcdb.2014.09.004
19 Jiang YQ ,  Wang ZX ,  Zhong M ,  Shen LJ ,  Han X ,  Zou X ,  Liu XY ,  Deng YN ,  Yang Y ,  Chen GH ,  Deng W & Huang JH .  Investigating mechanisms of response or resistance to immune checkpoint inhibitors by analyzing cell-cell communications in tumors before and after programmed cell death-1 (PD-1) targeted therapy: an integrative analysis using single-cell RNA and bulk-RNA sequencing data. Oncoimmunology. 10(1) 1908010 2021. DOI: 10.1080/2162402X.2021.1908010
20 Casar B ,  Badrock AP ,  Jiménez I ,  Arozarena I ,  Colón-Bolea P ,  Lorenzo-Martín LF ,  Barinaga-Rementería I ,  Barriuso J ,  Cappitelli V ,  Donoghue DJ ,  Bustelo XR ,  Hurlstone A & Crespo P .  RAS at the Golgi antagonizes malignant transformation through PTPRκ-mediated inhibition of ERK activation. Nat Commun. 9(1) 3595 2018. DOI: 10.1038/s41467-018-05941-8
21 Xu X ,  Li D ,  Liu J ,  Ma Z ,  Huang H ,  Min L ,  Dai L & Dong S .  Downregulation of PTPRK promotes cell proliferation and metastasis of NSCLC by enhancing STAT3 activation. Anal Cell Pathol (Amst). 2019 4265040 2019. DOI: 10.1155/2019/4265040
22 Young KA ,  Wojdyla K ,  Lai T ,  Mulholland KE ,  Aldaz Casanova S ,  Antrobus R ,  Andrews SR ,  Biggins L ,  Mahler-Araujo B ,  Barton PR ,  Anderson KR ,  Fearnley GW & Sharpe HJ .  The receptor protein tyrosine phosphatase PTPRK promotes intestinal repair and catalysis-independent tumour suppression. J Cell Sci. 137(14) jcs261914 2024. DOI: 10.1242/jcs.261914
23 Nanayakkara M ,  Bellomo C ,  Furone F ,  Maglio M ,  Marano A ,  Lania G ,  Porpora M ,  Nicoletti M ,  Auricchio S & Barone MV .  PTPRK, an EGFR phosphatase, is decreased in CeD biopsies and intestinal organoids. Cells. 12(1) 115 2022. DOI: 10.3390/cells12010115
24 Storm EE ,  Durinck S ,  De Sousa E Melo F ,  Tremayne J ,  Kljavin N ,  Tan C ,  Ye X ,  Chiu C ,  Pham T ,  Hongo J ,  Bainbridge T ,  Firestein R ,  Blackwood E ,  Metcalfe C ,  Stawiski EW ,  Yauch RL ,  Wu Y & De Sauvage FJ .  Targeting PTPRK-RSPO3 colon tumours promotes differentiation and loss of stem-cell function. Nature. 529(7584) 97 - 100 2016. DOI: 10.1038/nature16466
25 Gilglioni EH ,  Li A ,  St-Pierre-Wijckmans W ,  Shen TK ,  Pérez-Chávez I ,  Hovhannisyan G ,  Lisjak M ,  Negueruela J ,  Vandenbempt V ,  Bauzá-Martinez J ,  Herranz JM ,  Ezeriņa D ,  Demine S ,  Feng Z ,  Vignane T ,  Otero Sanchez L ,  Lambertucci F ,  Prašnická A ,  Devière J ,  Hay DC ,  Encinar JA ,  Singh SP ,  Messens J ,  Filipovic MR ,  Sharpe HJ ,  Trépo E ,  Wu W & Gurzov EN .  PTPRK regulates glycolysis and de novo lipogenesis to promote hepatocyte metabolic reprogramming in obesity. Nat Commun. 15(1) 9522 2024. DOI: 10.1038/s41467-024-53733-0
26 Flavell JR ,  Baumforth KRN ,  Wood VHJ ,  Davies GL ,  Wei W ,  Reynolds GM ,  Morgan S ,  Boyce A ,  Kelly GL ,  Young LS & Murray PG .  Down-regulation of the TGF-beta target gene, PTPRK, by the Epstein-Barr virus–encoded EBNA1 contributes to the growth and survival of Hodgkin lymphoma cells. Blood. 111(1) 292 - 301 2008. DOI: 10.1182/blood-2006-11-059881
27 Naeem M ,  Ahmed K & Sultan A .  Mutational and expression analysis of classical protein tyrosine phosphatase genes in pancreatic ductal adenocarcinoma. Comput Biol Med. 193 110319 2025. DOI: 10.1016/j.compbiomed.2025.110319
28 Badea L ,  Herlea V ,  Dima SO ,  Dumitrascu T & Popescu I .  Combined gene expression analysis of whole-tissue and microdissected pancreatic ductal adenocarcinoma identifies genes specifically overexpressed in tumor epithelia. Hepatogastroenterology. 55(88) 2016 - 2027 2008.
29 Moffitt RA ,  Marayati R ,  Flate EL ,  Volmar KE ,  Loeza SG ,  Hoadley KA ,  Rashid NU ,  Williams LA ,  Eaton SC ,  Chung AH ,  Smyla JK ,  Anderson JM ,  Kim HJ ,  Bentrem DJ ,  Talamonti MS ,  Iacobuzio-Donahue CA ,  Hollingsworth MA & Yeh JJ .  Virtual microdissection identifies distinct tumor- and stroma-specific subtypes of pancreatic ductal adenocarcinoma. Nat Genet. 47(10) 1168 - 1178 2015. DOI: 10.1038/ng.3398
30 Feng S ,  Tan H ,  Ling H & Yuan X .  [Detecting overexpression level of HER2 gene in NSCLC by real-time quantitative PCR and the 2[-Delta Delta C(T)] method]. Zhongguo Fei Ai Za Zhi. 14(12) 938 - 942 2011. DOI: 10.3779/j.issn.1009-3419.2011.12.07
31 Fang Z ,  Bunston C ,  Xu Y ,  Ruge F ,  Sui L ,  Liu M ,  Al-Sarireh B ,  Griffiths P ,  Murphy K ,  Pugh MR ,  Hao C ,  Jiang WG & Ye L .  Implication of capillary morphogenesis gene 2 (CMG2) in the disease progression and peritoneal metastasis of pancreatic cancer. Cancers (Basel). 16(16) 2893 2024. DOI: 10.3390/cancers16162893
32 Wang Z .  Cell cycle progression and synchronization: an overview. Methods Mol Biol. 2579 3 - 23 2022. DOI: 10.1007/978-1-0716-2736-5_1
33 Fischer M ,  Schade AE ,  Branigan TB ,  Müller GA & DeCaprio JA .  Coordinating gene expression during the cell cycle. Trends Biochem Sci. 47(12) 1009 - 1022 2022. DOI: 10.1016/j.tibs.2022.06.007
34 Schirripa A ,  Sexl V & Kollmann K .  Cyclin-dependent kinase inhibitors in malignant hematopoiesis. Front Oncol. 12 916682 2022. DOI: 10.3389/fonc.2022.916682
35 Knudsen ES ,  Witkiewicz AK & Rubin SM .  Cancer takes many paths through G1/S. Trends Cell Biol. 34(8) 636 - 645 2024. DOI: 10.1016/j.tcb.2023.10.007
36 Creff J & Besson A .  Functional versatility of the CDK inhibitor p57(Kip2). Front Cell Dev Biol. 8 584590 2020. DOI: 10.3389/fcell.2020.584590
37 Nilmani ,  D’costa M ,  Bothe A ,  Das S ,  Udhaya Kumar S ,  Gnanasambandan R & George Priya Doss C .  CDK regulators—Cell cycle progression or apoptosis—Scenarios in normal cells and cancerous cells. Adv Protein Chem Struct Biol. 135 125 - 177 2023. DOI: 10.1016/bs.apcsb.2022.11.008
38 Mansilla SF ,  de la Vega MB ,  Calzetta NL ,  Siri SO & Gottifredi V .  CDK-independent and PCNA-dependent functions of p21 in DNA replication. Genes (Basel). 11(6) 593 2020. DOI: 10.3390/genes11060593
39 Saleban M ,  Harris EL & Poulter JA .  D-type cyclins in development and disease. Genes (Basel). 14(7) 1445 2023. DOI: 10.3390/genes14071445
40 Maura F & Bergsagel PL .  Molecular pathogenesis of multiple myeloma: Clinical implications. Hematol Oncol Clin North Am. 38(2) 267 - 279 2024. DOI: 10.1016/j.hoc.2023.12.010
41 Banimohammad M ,  Khalafi P ,  Gholamin D ,  Bangaleh Z ,  Akhtar N ,  Solomon AD ,  Prabhakar PK ,  Sanami S ,  Prakash A & Pazoki-Toroudi H .  Exploring recent advances in signaling pathways and hallmarks of uveal melanoma: a comprehensive review. Explor Target Antitumor Ther. 6 1002306 2025. DOI: 10.37349/etat.2025.1002306
42 Marini F ,  Giusti F ,  Palmini G ,  Perigli G ,  Santoro R & Brandi ML .  Genetics and epigenetics of parathyroid carcinoma. Front Endocrinol (Lausanne). 13 834362 2022. DOI: 10.3389/fendo.2022.834362
43 Raghani NR ,  Shah DD ,  Shah TS ,  Chorawala MR & Patel RB .  Combating relapsed and refractory Mantle cell lymphoma with novel therapeutic armamentarium: Recent advances and clinical prospects. Crit Rev Oncol Hematol. 190 104085 2023. DOI: 10.1016/j.critrevonc.2023.104085
44 D’Amore PA & Alcaide P .  Macrophage efferocytosis with VEGFC and lymphangiogenesis: rescuing the broken heart. J Clin Invest. 132(9) e158703 2022. DOI: 10.1172/JCI158703